Sera were sourced from sheep vaccine trials carried out at Moredun Research Institute (see Table 1). Each serum pool, stored at −20°C, was thawed and diluted fourfold in binding buffer and IgG was extracted using a 1 mL Hi Trap Protein G HP column (17-0404-01, GE Healthcare Life Sciences, Little Chalfont, UK) according to the supplier’s instructions. Neutralized IgG fractions were pooled, concentrated and buffer exchanged to 10 mm Tris–HCl pH 8·0 using an Amicon Ultra-15 centrifugal filter device (Z706345, Sigma-Aldrich Company Ltd., Dorset, UK) centrifuged at 3500 × g and 4°C repeatedly until more than

120 mL of filtrate had been collected. The IgG was then stored at −20°C in 100-μL aliquots. Prior to freezing, 2·4 mg H-gal-GP (prepared as described earlier) was buffer exchanged to 0·1 m NaHCO3 pH 8·3 with 0·5 m NaCl this website coupling buffer (using an Amicon Ultra-15 centrifugal device as described above) and coupled to 0·5 g of cyanogen bromide-activated sepharose 4 fast flow (C5338, Sigma-Aldrich Company Ltd., Dorset, UK) according to the manufacturer’s protocol (GE Healthcare 71-5000-15 AD). The column was stored at 4°C. Sera obtained from sheep immunized with native H-gal-GP and QuilA adjuvant (Table 1) was diluted

twofold in 0·1 m Tris–HCl 0·5 m NaCl pH 8·0 and 2 mL of the diluted sera was pumped at 0·5 mL/min Talazoparib molecular weight onto the H-gal-GP affinity column which had been pre-equilibrated with the same buffer. After the unbound material

had been washed away, the bound material was eluted with 0·1 m sodium acetate buffer 0·5 m NaCl, pH 3·9. This eluate was neutralized by addition of 1 m Tris buffer (base) at 10% of the total volume, concentrated, buffer exchanged to 10 mm Tris–HCl pH 8·0 as previously described and stored at −20°C in 100-μL aliquots. For host haemoglobin digestion reactions, H-gal-GP (30 μg/mL) or dH2O (for enzyme-free control reactions) was incubated at 37°C with haemoglobin (1·2 mg/mL) in 0·1 m acetate, phosphate or phosphate-citrate buffer over pH 2·4–8·0. Samples for TCA (trichloroacetic Rebamipide acid) precipitation were taken every 13 min from 0 to 117 min and at 24 h. Gel samples were taken at 0, 1·5, 2 and 24 h. For TCA sampling equal volumes (30 μL) of reaction solution and cold 5% TCA were added and stored at 4°C. After centrifugation (18,000 × g for 10 min), 50 μL of supernatant was added to an equal volume of 2% ninhydrin reagent (Sigma N7285). After a 15-min incubation at 100°C, 250 μL of cold 50% ethanol solution was added and the solution kept on ice. Then, 200 μL of the supernatant was transferred to microplate wells and the absorbance at 562 nm was measured. After subtraction of control reaction values, the absorbance values were plotted against corresponding sampling times. The gradient gave the initial rate. For gel analysis, 10 μL of reaction solution was added to an equal volume of sample buffer (NuPAGE LDS NP0007, Invitrogen Ltd.

Distal colon tissue gene

expression was measured by qRT–PCR. Distal colons (3 cm) were divided into three sections with one section frozen at −80°C in RNAlater (Sigma Aldrich, Dublin, Ireland). Colon tissue samples were thawed on ice and transferred to magNALyser green bead tubes (Roche Applied Sciences, West Sussex, UK) and homogenized using the magNALyser homogenizer three times for 15 s at ×6500 (Roche). Colonic tissue was homogenized in RLT lysis buffer (Qiagen Ltd, Manchester, UK) with homogenized samples centrifuged for 5 min at 4°C at 200 g. Supernatants were stored at −80°C until required. Total RNA was extracted using the RNeasy mini selleck kinase inhibitor kit (Qiagen). One μg total RNA was used to synthesize cDNA with random hexamer primers

using transcriptor reverse transcriptase (Roche). qRT–PCR was performed using the LightCycler 480 (Roche). Primers were designed using the Universal Probe Library system (Roche), as follows: IL-6 (forward = TCTAATTCATATCTTCAACCAAGAGG, reverse = TGGTCCTTAGCCACTCCTTC); tumour necrosis factor (TNF)-α (forward = TCTTCTCATTCCTGCTTGTGG, reverse = GGTCTGGGCCATAGAACTGA); IL-1β (forward = TGTAATGAAAGACGGCACACC, reverse = TCTTCTTTGGGTATTGCTTGG); CXCL1 (forward = AGACTCCAGCCACACTCCAA, reverse = TGACAGCGCAGCTCATTG); FG-4592 chemical structure IL-22 (forward = TTTCCTGACCAAACTCAGCA, reverse = CTGGATGTTCTGGTCGTCAC);

and IL-17A Forskolin cell line (forward = CAGGGAGAGCTTCATCTGTGT, reverse = GCTGAGCTTTGAGGGATGAT) was measured and normalized to 18S (forward = AAATCAGTTATGGTTCCTTTGGTC, R = GCTCTAGAATTACCACAGTTATCCAA). Gene expression changes were calculated using the 2-ΔΔCT method. Human tissue arrays (CD/Colitis cDNA Array; Origene, Rockville, MD, USA) were used to measure Bcl-3 expression. Gene expression was measured using the LightCycler 480 system in combination with Taqman gene expression assay for Bcl-3 (Applied Biosystems/Life Technologies, Grand Island, NY, USA). Relative mRNA was calculated using the 2-ΔΔCT method. Transcriptional profiling of CD and UC tissue was performed using a data set of sigmoid biopsy patient samples published by Costello et al. (GEO data set ID GDS1330) [21] (CD n = 10, UC n = 10, normal controls n = 11). The extent of apoptosis in colonic tissue between groups was measured by TUNEL. Six-μm colonic tissue sections were incubated with 3% H2O2 and a 4% diethyl pyrocarbonate (DEPC) solution to eliminate background from both peroxidase and endonuclease enzyme activity in the tissue.

Agaricus blazei Murill, like Gf, is rich

in immunostimulatory mixture of β(1-3)-, β(1-4)- and β(1-6)-d-glucans with antitumour activity [4], probably secondary to modulation of NK-cells [5] and monocytes/macrophages of native PI3K activation immunity [6–8]. In vitro AbM stimulates mononuclear phagocytes to secrete nitric oxide [9] and pro-inflammatory cytokines like IL-1β, IL-6 and TNF-α and chemokine IL-8 [9, 10]. Recently, the stimulatory effect of the AbM-based mushroom extract (AndoSan™; ACE Co. Ltd., Gifu, Japan) on cytokine production (TNF-α, IL-1β, IL-6, IL-8, G-CSF and MIP-1β) in monocyte-derived dendritic cells has also been demonstrated [11]. The effects are probably mediated by binding of sugars in AbM to Toll-like

receptor-2 (TLR-2) [12], but also to dectin-1 [13] and the lectin-binding site of CD11b/18 [14] and possibly CD11c/18 [15]. Gene microarray expression analysis of promonocytic THP-1 tumour cells [16] supported these results because stimulation with AbM strongly upregulated genes for IL-1β and IL-8, moderately for TLR-2 and co-operative molecule MyD88, but not for TLR-4. On the other hand, daily consumption of 60 ml of the current AbM-based extract for 7 days in patients with chronic hepatitis C [17] had no effect in vivo on the expression of these Decitabine price genes in blood cells. Recently, we reported that AbM stimulation of whole blood ex vivo [18] stimulated the release of all the 17 different cytokines, chemokines and leucocyte growth factors tested. The cytokines were pro-inflammatory (IL-1β, IL-6, TNF-α), anti-inflammatory (IL-10) and pleiotropic P-type ATPase (IL-7, IL-17) and of the Th1- (IFN-γ, IL-2, IL-12) and Th2 types (IL-4, IL-5, IL-13). In addition, chemokines IL-8, MIP-1β, MCP-1 and

leucocyte growth factors G-CSF and GM-CSF were also studied. On the other hand, when blood was collected from volunteers prior to and 12 days after their daily intake (60 ml) of AbM, there was in vivo either a significant reduction in cytokine levels for IL-1β, TNF-α, IL-6, IL-2 and IL-17 or unaltered levels of the remaining 12 factors. This pointed to a stabilizing and anti-inflammatory effect of AbM in vivo when given via the oral route. Patients with inflammatory bowel disease (IBD) like ulcerative colitis (UC) and Crohn’s disease (CD) have in the colon mucosa an unselective increase in chemokine expression including that of MIP1-β, MCP-1 and IL-8 [19] as well as cytokines IL-1β [20], IL-6 and TNF-α [21]. Cytokine levels in serum, however, are less extensively studied, but increased levels of IL-6 [22] and TNF-α [23, 24] have been detected in patients with UC and CD. Recently, increased serum levels of the chemokine MIP-1β were found in patients with UC [25]. The IBD, UC and CD are autoimmune diseases of Th2 and Th1 nature, respectively.

Donor proteinuria in the absence of other significant factors influencing organ acceptance, appears to be of little importance in influencing graft outcome. Larger studies are required to further examine this. 254 AMBULATORY VS OFFICE BLOOD PRESSURE MONITORING IN RENAL TRANSPLANT RECIPIENTS J AHMED, V OZORIO, M FARRANT, W VAN DER MERWE North Shore hospital, Lapatinib clinical trial Auckland,

New Zealand Aim: To investigate correlation between office (OBPM) and ambulatory (ABPM) blood pressure monitoring in renal transplant recipients (RTR). Background: Hypertension is common post renal transplant and has adverse effects on cardiovascular and graft health. Nocturnal hypertension, which is also implicated in poor outcomes, can only be diagnosed via ABPM. ABPM is increasingly being recognized as a better method of measuring BP with discrepancies between office (oBP) and ambulatory BPs (aBP) being noted in RTR. Methods: We undertook a retrospective analysis of 98 renal transplant recipients (RTR) (40% female, average age 55) in our unit and compared oBP and aBP recordings. Baseline demographic data was recorded along with click here eGFR, proteinuria, medications and co-morbidities. Results: ABPM revealed 28.5% and 13.2% had concordant normotension and hypertension

respectively. There was a discordance between OBPM and ABPM in 58% of patients with 53% due to masked hypertension (of which 34% were due to isolated nocturnal hypertension) and 5% had white coat hypertension. Overall mean systolic BP was 3.6 mmHg (0.5–6.5) and diastolic BP 7.5 mmHg (5.7–9.3) higher via ABPM than

OBPM (95% confidence). This was independent of eGFR, proteinuria, transplant time/type and comorbidities. 41% of patients had their management changed after results from ABPM. Conclusions: There is a significant discordance between OBPM and ABPM with a predominance of masked hypertension. The results of ABPM changed management Urease in a significant proportion of patients. ABPM is the only means to diagnose nocturnal hypertension and should be routinely offered as part of hypertension management of RTR. 255 ANNUAL SKIN CANCER INCIDENCE IN RENAL TRANSPLANT RECIPIENTS 1997–2013: A SINGLE CENTRE EXPERIENCE G DAS1, B TAN1,2, K NICHOLLS1,3 Departments of 1Nephrology and 2Dermatology, The Royal Melbourne Hospital, Melbourne; 3Department of Medicine, The University of Melbourne, Melbourne, Australia Aim: To evaluate annual incidence of skin cancers (SC) in renal transplant recipients (RTR) in our hospital (RMH) from 1997 to 2013. Background: ANZDATA data indicates that RTR have a 100 fold increased risk of developing SCC. There is no clear evidence that SC incidence has fallen over time, or with different immunosuppressive regimens. Methods: We retrospectively studied RMH patients transplanted between January 1997 and December 2013, extracting data from medical records, our departmental database, and pathology reports.

1 In primed T cells, topographical memory is endowed by the stable expression of homing and chemokine receptors that promote their interactions with ligands expressed

by the endothelium of specific organs, such as the skin and the gut.7 Memory T cells with tropism for the skin are characterized by the expression of the carbohydrate epitope cutaneous lymphocyte antigen (CLA),10 and the chemokine receptors CCR411 and/or CCR10.12 CLA mediates the tethering and rolling of T cells through interaction with its endothelial counter-receptor, E-selectin, which is constitutively expressed on skin post-capillary venules. The ligands for CCR4 and CCR10, which are, respectively, chemokine (C-C motif) ligand ACP-196 17 (CCL17) thymus and activation-regulated chemokine (TARC) and CCL27 cutaneous T cell-attracting chemokine (CTACK), have been found on inflamed and non-inflamed skin endothelium.11,13 CCL17 (TARC) was shown to selectively induce Selleck INCB018424 integrin-dependent adhesion to intercellular adhesion molecule 1 (ICAM-1) of skin-derived memory T cells under static conditions and under physiological flow,11 while CCL27 (CTACK) was found to be preferentially produced by epidermal keratinocytes, and its chemotactic effect

on T cells was demonstrated in in vitro assays.13 Constitutive memory T-cell trafficking into the lamina propria of the small intestine requires the interaction of the integrin α4β7 and the chemokine receptor CCR9 on the lymphocyte surface14 with mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) and CCL25 thymus-expressed chemokine (TECK) on endothelial cells of gut lamina propria venules, respectively.15 T cells lacking β7-integrin chain expression are severely impaired in their ability to localize to the intestinal mucosa16 and CCL25 blockade or genetic ablation of CCR9 significantly reduces antigen-specific Dehydratase CD8+ T-cell migration to the small

intestine.17 Additional adhesion molecules, such as vascular adhesion protein-1 (VAP-118) and CD44,19 may contribute to a significant diversity of potential address codes, but selectins, α4-integrins, β2-integrins, and chemokine receptors and their respective ligands appear to be the workhorses of the system with differential but broadly overlapping functions at the various destinations of lymphocyte trafficking. The paradigm of organ-specific homing is based on the assumption that T-cell priming within a specific tissue environment, such as cutaneous and mesenteric lymph nodes (MLNs), leads to an imprinting of the expression of specific homing receptors.17,20,21 Recent studies have shown that tissue-derived dendritic cells (DCs) are key mediators of the induction of T-cell tissue-specific homing potential.

Of note, these occurrences are likely polygenic, pertaining to genes such as the genes of human leucocyte antigen (HLA), KIR and class cytokine receptor [12]. NK cells can play a crucial role in the innate response to infection by lysis of infected cells and by secretion of proinflammatory cytokines (such as IFN-γ) that

promote phagocytic clearance of microbes [13]. NK cell activity is regulated by an extensive repertoire of regulatory receptors. The most polymorphic receptors belong to the KIR family [14]. A number of studies implicated KIR diversity in susceptibility learn more to both infectious and non-infectious diseases [14, 15]. KIR genes provide activating or inhibitory Selleckchem PD0332991 signals to regulate the activation of NK cells and T cells and play an important role in anti-micro-organism immunity [15]. The combination of maternal and paternal haplotypes with distinct gene content produces diversity among individuals in their KIR gene content profile (KIR genotype), which may influence the individuals’ immunity and susceptibility or resistance to diseases. Interestingly, several clinical studies have shown associations between diseases and KIR genotypes. For example, individuals with KIR genotype A/A were reported to relatively protect against chronic inflammatory diseases [16,

17], and individuals with genotype A/B were significantly more likely to remain seronegative than those with genotype A/A among long-term HIV-exposed subjects [18]. However, the role of overall KIR genotype in patients with syphilis remains unclear up to now. The objective of this study was to examine whether the KIR genotypes and haplotypes influence susceptibility or resistance to syphilis. Therefore, we analysed KIR genes in a Chinese Han population of 190 patients with syphilis and 192 healthy controls by means of polymerase chain reaction with sequence-specific

primers (PCR–SSP). Patients and controls.  One hundred and ninety unrelated patients with syphilis, who were diagnosed at Jinan Hospital of Dermatosis, were enrolled as the case group. The diagnosis of syphilis was based on the criteria for syphilis of the Health Ministry of the People’s Republic of China (WS 273-2007). The toluidine red unheated serum test OSBPL9 (TRUST) and the T. pallidum particle agglutination assay test (TPPA) were performed for all patients. Both TRUST and TPPA were positive for the patients, and the TRUST titre ranged from 1:4 to 1:128. Of these patients, 108 were men and 82 were women, and their ages ranged from 19 to 55 years, with an average age of 34 years. Meanwhile, 192 healthy subjects were from Chinese marrow donors consisted of 159 men and 33 women, and their ages ranged from 18 to 44 years, with an average age of 28 years. Both TRUST and TPPA were negative for all controls.

In order to identify new expansion factors, we performed oligonucleotide microarray analyses on IL-1β-stimulated ECs in combination with

analyses of the hematopoietic properties of candidate factors using delta and colony assays in combination with flow cytometry. Time course oligonucleotide microarrays were performed in order to elucidate endothelial factors involved in HPC proliferation and differentiation. Measurements were taken for IL-1β-stimulated EC samples after 4, 8 and 16 h, and for control ECs without IL-1β (0 and 16 h). A hierarchical cluster analysis of expression profiles revealed two clusters. While the gene signals from the IL-1β-stimulated EC samples at different time points were clustered together, the control ECs without IL-1β

(0 and 16 h) were assigned to the other cluster, suggesting learn more that the expression EPZ-6438 concentration changes caused by IL-1β dominate over expression changes over time (Fig. 1A). A pair-wise display of logged (base 2) expression values indicates a strong overall correlation between the EC samples, i.e. only a subset of genes is differentially expressed (Fig. 1B). The larger scattering of expression values between the treated and control EC groups compared with the scattering within these groups confirms the results of the clustering analysis. A total of 198 genes significantly changed (false discovery rate <0.2) with 165 being upregulated. Especially after 4 h of IL-1β stimulation, many differentially

expressed genes were detected (Fig. 1C and D). To identify temporal expression patterns, we clustered genes based on their corresponding microarray signals. The subsequent assessment of the functional composition of detected gene clusters demonstrated that the majority of upregulated genes are involved in immune responses and cytokine activity (Fig. 1E). The discovered clusters indicate several distinct, increased temporal expression responses to IL-1β stimulation. Most expression increases occurred when the endothelium had been subjected to IL-1β for 4 h (cluster 1, 3, 4, 5, 7 and 8); gene signal intensities remained high throughout the observed time span in four clusters mafosfamide (1, 5, 7 and 8). The set of differentially expressed genes provided numerous candidates for novel factors of HPC proliferation. However, the large number of differentially regulated genes would pose considerable challenges in their individual validation. For a more efficient identification of potential HPC expansion factors, we utilized additional annotations provided by gene ontology (GO). Here, we focused on gene products associated with cytokine activity, receptor binding and extracellular region/space. Remarkably, the integration of gene annotation and expression data enabled us to rapidly assemble a concise list of promising candidate genes for further validation.

So far, no studies on the strengthening of SOCS1 action in inflamed skin cells or during immune-mediated skin diseases have been reported. To this regards, through a screening of a focused combinatorial peptide library, we identified a pseudosubstrate-based peptide inhibitor of JAK2, named PS-5, which mimics the KIR domain of SOCS1 protein and, selleck products as a direct consequence of its binding to JAK2, inhibits the phosphorylation of STAT1 [14]. PS-5

differed from SOCS1 KIR sequence in amino acid composition and length, since some KIR residues were deleted or substituted to improve its uptake by keratinocytes or binding to JAK2, respectively. In particular, the substitution of phenylalanine and arginine residues in positions 55 and 56 of KIR sequence with arginine and glutamine amino acids respectively improved PS-5 binding to JAK2, likely by establishing

more intense electrostatic or polar interactions with the negative phosphate moiety on Y1007. Furthermore, PS-5 contains a nonnatural residue (Cys(Acm)) that renders this sequence more stable to protease degradation [14]. In this study, we evaluated the effects of PS-5 mimetic on the immune functions of IFN-γ-activated epidermal keratinocytes. We found that PS-5 suppressed IFN-γRα and JAK2 phosphorylation in these cells and, in turn, impairs the phosphorylation and the transcriptional activity of STAT1. As a direct consequence, the expression levels of IRF1, a late transcription factor induced by IFN-γ, were reduced upon PS-5 treatment. In turn, PS-5 strongly reduced CXCL10 and CCL2 release upon IFN-γ stimulation, check details and completely abrogated HLA-DR induction in keratinocytes, whereas it partly dampened IFN-γ-induced ICAM-1 expression. These results are in line with our observation that STAT1 depletion in IFN-γ-activated keratinocytes reduced CXCL10 and CCL2 chemokine release, as well as HLA-DR expression, and with previous studies showing that STAT1 is responsible for CXCL10, CCL2, and HLA-DR transcription [24, 25]. In contrast, ICAM-1 expression was

partly dampened by PS-5 treatment, as well as by STAT1 knockdown, in line with previous data obtained in STAT1-depleted hepatocytes or endothelial cells [26]. This is Exoribonuclease probably because other STATs (such as STAT3 and STAT5) may also be involved in ICAM-1 induction. Due to the crucial antiinflammatory and protective role that RAS/ERK signaling plays in cytokine-activated human keratinocytes [9, 27], we evaluated the effects of PS-5 treatment on ERK1/2 phosphorylation upon IFN-γ stimulation. Interestingly, we found that PS-5 did not affect ERK1/2 phosphorylation in IFN-γ-activated keratinocytes, indicating that the PS-5 mimetic peptide could not significantly influence processes involved in the reestablishment of the cellular homeostasis, such as survival and proliferation.

In conclusion, this study demonstrated for the first time that local or systematic hypoxia might contribute to Th17 upregulation and IL-17A expression in PBMC obtained from severe ischemic stroke patients during its chronic stage. Forthcoming studies will be attempted to clarify the in vivo effect of IL-17A and Th17 in relapsed ischemic stroke patients and the precise mechanism should be studied. Selumetinib in vitro We gratefully acknowledge Miss BaiQiu Wang (Canada) for language assistance. These studies were financially supported by the National Natural

Science Foundation of China (no. 30570619). “
“Helper T (Th)-cell differentiation is a key event in the development of the adaptive immune response. By the production of a range of cytokines, Th cells determine the type of immune response that is raised against an invading pathogen. Th cells can adopt many different phenotypes, and Th-cell

phenotype decision-making is crucial in mounting effective host responses. This review discusses the different Th-cell phenotypes that have been identified and how Th cells adopt a particular phenotype. The regulation of Th-cell phenotypes has been studied extensively using mathematical models, which have explored the role of regulatory mechanisms such as autocrine cytokine signalling and cross-inhibition between self-activating transcription factors. At the single cell level, Th responses tend to be heterogeneous, but corrections can be made soon after T-cell activation. Although pathogens and the innate immune system provide signals that direct the induction GDC-0449 of Th-cell phenotypes, these instructive mechanisms could be easily subverted by pathogens. We discuss that a model of success-driven feedback would select the most appropriate phenotype for clearing a pathogen. Given the heterogeneity in the induction phase of the Th response, such a success-driven feedback loop would allow the selection of effective Th-cell phenotypes while terminating incorrect responses.

Immunity to pathogens involves many different effector mechanisms. Almost all species have some form of innate immunity consisting of rapid and generic responses to evolutionary conserved molecules expressed Rebamipide by particular pathogens. Examples are the lypopolysaccharide molecules of bacterial cell walls and viral RNA. On top of this innate system, vertebrates have evolved the adaptive immune system comprised of B and T lymphocytes that specifically respond to arbitrary novel molecules, that is, antigens, which only have to be different from all the normal molecules in the host. The antigen receptors of B and T cells are generated by somatic recombination of small gene segments, with random addition and deletion of nucleotides at the junctions, leading to vast ‘random’ repertoires of rare naïve lymphocytes expressing a unique antigen receptor.

These signals trigger cAMP production, protein kinase C (PKC) translocation, Mitomycin C cell line CD86 expression, increased levels of tyrosine phosphorylation, calcium mobilization and increased levels of MEK1/2, ERK1/2, AP-1,

nuclear factor (NF)-κB and NFAT dephosphorylation [4, 9, 11-13]. MHC class II molecules also appear to be involved in negative aspect in signalling process including apoptotic cell death. For example, MHC class II-related death signalling, involving caspase- and Fas/CD95-independent pathways, has been demonstrated to be selectively affected in abnormally activated cells [14, 15]. In a previous study, we reported that cross-linking of MHC class II molecules inhibited the activation of resting B cells. It has also been shown that ERK and p38 mitogen-activated protein (MAP) kinases as well as protein kinase C are involved in lipopolysaccharide (LPS)-induced MHC class II-mediated signal transduction in resting B cells HM781-36B cost [6]. In addition, it was shown that interference of phorbol 12,13-dibutyrate (PDBU)-mediated differentiation of resting B cells was due to inhibition of the Rac-associated ROS-dependent ERK/p38 MAP kinase

pathway resulted in nuclear factor-κB (NF-κB) activation [16]. Moreover, Rac/ROS-related protein kinase C and phosphatidylinositol-3-kinase signalling have been shown to be involved in the negative regulation of B cell activation induced by antibody-mediated cross-linking of MHC class II molecules [17]. An understanding of the signalling mechanisms involved in the negative regulation of B cell activation could reveal therapeutic targets and lead to the development of diagnostic tools for diseases caused by abnormal activation of B cell function; discovery of molecules associated with MHC class II signal transduction is therefore of great interest. In this study, we applied a novel method to identify molecules involved in MHC class II-associated signal transduction in resting

B cells. We identified MHC class II-associated proteins crotamiton whose expression was increased by LPS treatment but inhibited by additional anti-MHC class II antibody treatment using a combination of immunoprecipitation and proteomic analysis. We initially identified 10 candidate proteins that showed a differential expression pattern depending on LPS or anti-MHC class II antibody treatment of 38B9 resting B cells. Among these proteins, we selected pro-IL-16 and analysed its role in resting B cell function based on previous reports of the inhibitory role of IL-16 in T cell activation, where IL-16 acted as an immunomodulator by impairing antigen-induced activation. Furthermore, the precursor of IL-16, namely pro-IL-16, has also been suggested to play a role in regulating the cell cycle in T lymphocytes and human cutaneous T cell lymphoma [18, 19].