3a). All four of these inhibitory compounds reduced the biomass by over 80% at the highest concentration (25 mM), with decanol, dodecanol and decanoic acid showing no significant differences between their concentration-dependent inhibitory profiles across the range tested. Biomass inhibition by octanoic acid was not observed until ≥1.6 mM. The three most effective exogenous inhibitory compounds were tested against preformed mature MAPK inhibitor A. fumigatus biofilms. The biomass of A. fumigatus biofilms was shown to be reduced by all three compounds in a concentration-dependent manner, with decanol showing a reduction across the entire concentration range tested,

whereas both decanoic acid and dodecanol did not reduce the biomass significantly until concentrations of 1.6 mM were applied. All

three agents reduced the biomass by ≥85% at 25 mM (Fig. 3b). The pulmonary cavity of CF patients is a unique environment impacted by a complex microbial ecology. However, to date, relatively little is known about bacterial–fungal cross kingdom interactions within the CF lung. Cell-to-cell signalling is thought to play an important role in determining the ability of particular pathogens to compete with each other for space and nutrients and may contribute to the ability of microorganisms to persist within the CF pulmonary cavity. The data presented herein are suggestive that an antagonistic relationship exists between A. fumigatus and P. aeruginosa, which is influenced through the RANTES selleck products release of small diffusible extracellular molecules. Pseudomonas aeruginosa and A. fumigatus are frequently isolated from CF patients. Typically by the age of 18, up to 80% of CF patients are infected with P. aeruginosa, whereas the incidence of A. fumigatus is somewhat variable in CF patients (Bakare et al., 2003; Valenza et al., 2008). This study demonstrated that P. aeruginosa significantly impedes A. fumigatus growth. This is in agreement with reports from elsewhere describing antagonistic properties for bacteria isolated from clinical pulmonary samples (Kerr et al., 1999; Yadav et al., 2005). However,

investigation of the antifungal properties of bacterial CF lung pathogens against a panel of fungi, including A. fumigatus, showed that P. aeruginosa clinical isolates were shown to be unable to completely inhibit A. fumigatus (Kerr, 1994a, b). In agreement, our data showed that once filamentous biofilms had been produced, the inhibitory capacity of P. aeruginosa was significantly restricted, with coaggregation upon hyphae observed throughout A. fumigatus biofilms. Recent studies report a similar phenomenon, where P. aeruginosa and C. albicans were shown to exhibit a degree of mutual inhibition within the biofilm (Bandara et al., 2010b), suggesting that these mixed species consortia play a role in the pathobiology of the CF lung.

2%) of participants self-identified as gay or homosexual. The cohort was highly educated, with more than half (51.9%) holding university or post-graduate qualifications, and 21.6% with tertiary diploma or technical and further education degrees. Nearly two-thirds of participants (913; 65.7%) were somewhat or very involved in the gay community in Sydney. By the end of the study in 2007, there were 53 HIV seroconversions identified, giving an overall HIV incidence of 0.78 per 100 PY [95% confidence interval

(CI) 0.59–1.02]. The total follow-up time was 5161 PY, and the median was 3.9 years per participant. Risk factor analysis was performed on 47 of the 53 HIV seroconverters who had sexual behaviour data available within 12 months of seroconversion. Risk factors associated with an HIV incidence of Bioactive Compound Library in vitro more than 2 per 100 PY are summarized in Table 1. In order of incidence they included reports in the past 6 months of UAI with a known HIV-positive partner, any injecting drug use, receptive UAI with a casual partner, any anal STI, both oral erectile dysfunction medication and methamphetamine use, more than 50 casual partners, having an HIV-positive regular partner, any oral erectile dysfunction medication use and any psychedelic/hallucinogen use (Table 1). The remaining risk factors examined had an HIV incidence

of <2 per 100 PY. Circumcision status (HIV incidence in uncircumcised C59 wnt manufacturer participants of 1.04 per 100 PY; 95% CI 0.58–1.20) and the use of ‘any recreational drugs’ (0.83 per 100 PY; 95% CI 0.77–1.41) in the past 6 months were associated with an HIV incidence of approximately 1 per 100 PY. Daily alcohol consumption

(1.48 per 100 PY; 95% CI 0.74–2.96) and prior HBV infection (1.24 per 100 PY; 95% CI 0.71–2.19) were each associated with an HIV incidence of <2 per 100 PY. When demographic factors including age, education, income and occupation were examined individually, none was found to be related to an HIV incidence of ≥2 per 100 PY (data not shown). In total, there were nine risk factors identified with an HIV incidence of 2 per 100 PY or higher (Table 1). The stepwise procedure described above was used to rank these nine risk factors. Thirteen of the total 47 HIV seroconversions were among men who reported the highest risk behaviour of UAI with an HIV-positive Anidulafungin (LY303366) partner. The group of participants reporting UAI with an HIV-positive partner were excluded from the analysis and the incidence in the remaining eight high-risk groups was recalculated. Receptive UAI with casual partners was the next highest risk group identified (2.43 per 100 PY; 95% CI 1.38–4.28), accounting for 12 of the remaining 34 HIV seroconversions (Table 2). After exclusion of those men, reported use of both oral erectile dysfunction medication and methamphetamines had the highest HIV incidence (1.67 per 100 PY; 95% CI 0.84–3.34). The combined HIV incidence among men who reported at least one of these three risk factors (hereafter called the ‘high-incidence’ subgroup) was 2.

flexneri) to localize at the cell pole(s) (Jain et al., 2006). The NalP autotransporter from Neisseria meningitidis localizes to the poles of E. coli during heterologous expression of the protein (Jain et al., 2006). In addition, the Listeria monocytogenes surface protein ActA localizes to the bacterial pole, where it is involved in actin-based motility (Rafelski & Theriot, 2006). These examples indicate that an array of bacterial virulence stratagems use polar localization as a means to secrete effector proteins into host cells. Coxiella burnetii’s ability to affect host cell function while sequestered in the PV, and the lack of understanding of its T4BSS structure,

led us to investigate the subcellular localization of the C. burnetii T4BSS. Using antibodies specific to the C. burnetii IcmT, IcmV, and DotH homologs, Afatinib indirect immunofluorescent antibody (IFA) assays demonstrated that IcmT, IcmV, and DotH localized to one or both poles of the bacterium. We confirmed these findings with immunoelectron microscopy (IEM). To our knowledge, this is the first demonstration of the specific subcellular

localization of this virulence machinery during C. burnetii infection. Coxiella burnetii Nine Mile Phase II Clone 4 (NMII) was propagated in African green monkey kidney (Vero) cells in Roswell Park Memorial Institute (RPMI) 1640 medium, 5% fetal bovine serum (FBS) at 37 °C in an atmosphere of 5% CO2, and the SCV form of the organism was isolated as described previously (Coleman et al., 2004). The SCVs were resuspended in SPG buffer (0.7 M sucrose, 3.7 mM KH2PO4, 6.0 mM K2HPO4, 0.15 M KCl, Navitoclax nmr and 5.0 mM glutamic acid, pH 7.4) and stored at −80 °C. Coxiella burnetii genome equivalents were calculated using qPCR (Brennan & Samuel, 2003). Uninfected Vero cells were propagated as described in a medium containing 20 μg mL−1 gentamicin. The medium was exchanged with fresh RPMI 1640, 5% FBS without antibiotics 2 h before bacterial infection. Vero cells were infected with C. burnetii NMII using a genome-equivalent Resveratrol MOI of

100. Infections were propagated as described for 3 weeks with periodic medium changes and maintenance of cell confluency as needed. The oligonucleotide primers used for the PCR amplification of icmT, icmV, and dotH from C. burnetii NMII genomic DNA were icmT: 5′CACCATGAAATCTCTCGATGAGG (forward) and 5′TTAGTTATCCCACCATGCTATGG (reverse), icmV: 5′CACCATGATTCTTTTGGAGTCTTCC (forward) and 5′TTATTGTTTGGACCCCTTAAAGGTG (reverse), dotH: 5′CACCATGGTGATTCGAAAAATTTTCC (forward) and 5′TTACAACCCTTCAATCATCAAC (reverse). Underlined and italicized bases, CACC and TTA, are non-C. burnetii sequences used for directional cloning and stop codon insertion, respectively. PCR products from each gene were ligated into the pET200/D-TOPO vector and transformed into E. coli TOP10 cells according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Selected clones were cultivated at 37 °C in Luria–Bertani broth containing 50 μg mL−1 kanamycin and sequence verified.

flexneri) to localize at the cell pole(s) (Jain et al., 2006). The NalP autotransporter from Neisseria meningitidis localizes to the poles of E. coli during heterologous expression of the protein (Jain et al., 2006). In addition, the Listeria monocytogenes surface protein ActA localizes to the bacterial pole, where it is involved in actin-based motility (Rafelski & Theriot, 2006). These examples indicate that an array of bacterial virulence stratagems use polar localization as a means to secrete effector proteins into host cells. Coxiella burnetii’s ability to affect host cell function while sequestered in the PV, and the lack of understanding of its T4BSS structure,

led us to investigate the subcellular localization of the C. burnetii T4BSS. Using antibodies specific to the C. burnetii IcmT, IcmV, and DotH homologs, Z-VAD-FMK order indirect immunofluorescent antibody (IFA) assays demonstrated that IcmT, IcmV, and DotH localized to one or both poles of the bacterium. We confirmed these findings with immunoelectron microscopy (IEM). To our knowledge, this is the first demonstration of the specific subcellular

localization of this virulence machinery during C. burnetii infection. Coxiella burnetii Nine Mile Phase II Clone 4 (NMII) was propagated in African green monkey kidney (Vero) cells in Roswell Park Memorial Institute (RPMI) 1640 medium, 5% fetal bovine serum (FBS) at 37 °C in an atmosphere of 5% CO2, and the SCV form of the organism was isolated as described previously (Coleman et al., 2004). The SCVs were resuspended in SPG buffer (0.7 M sucrose, 3.7 mM KH2PO4, 6.0 mM K2HPO4, 0.15 M KCl, MAPK inhibitor and 5.0 mM glutamic acid, pH 7.4) and stored at −80 °C. Coxiella burnetii genome equivalents were calculated using qPCR (Brennan & Samuel, 2003). Uninfected Vero cells were propagated as described in a medium containing 20 μg mL−1 gentamicin. The medium was exchanged with fresh RPMI 1640, 5% FBS without antibiotics 2 h before bacterial infection. Vero cells were infected with C. burnetii NMII using a genome-equivalent PRKD3 MOI of

100. Infections were propagated as described for 3 weeks with periodic medium changes and maintenance of cell confluency as needed. The oligonucleotide primers used for the PCR amplification of icmT, icmV, and dotH from C. burnetii NMII genomic DNA were icmT: 5′CACCATGAAATCTCTCGATGAGG (forward) and 5′TTAGTTATCCCACCATGCTATGG (reverse), icmV: 5′CACCATGATTCTTTTGGAGTCTTCC (forward) and 5′TTATTGTTTGGACCCCTTAAAGGTG (reverse), dotH: 5′CACCATGGTGATTCGAAAAATTTTCC (forward) and 5′TTACAACCCTTCAATCATCAAC (reverse). Underlined and italicized bases, CACC and TTA, are non-C. burnetii sequences used for directional cloning and stop codon insertion, respectively. PCR products from each gene were ligated into the pET200/D-TOPO vector and transformed into E. coli TOP10 cells according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Selected clones were cultivated at 37 °C in Luria–Bertani broth containing 50 μg mL−1 kanamycin and sequence verified.

Within the ITT and safety population, demographic and baseline characteristics of both treatment groups

were similar (Table 1). More individuals in the rifaximin group completed the 14-day treatment phase (88 of 106 patients; 83%) compared with those in the placebo group (69 of 104 patients; 66%; Figure 1). A dosing compliance rate of ≥70% was achieved by 98% of individuals in each treatment group. The percentage of participants who took concomitant medications during the study was similar in the rifaximin and placebo treatment groups (76% vs 79%, respectively). Primary and secondary end point analyses were evaluated for the modified ITT population. For the primary end point, prophylactic treatment with rifaximin 600 mg/d for 14 days significantly reduced the risk of developing TD versus placebo (p < 0.0001; Figure 2). Specifically, at the end of the see more Selleckchem GDC941 14-day treatment period, the cumulative occurrence of TD was 15% in the rifaximin group (15 of 99 patients) compared with 47% in the placebo group (48 of 102 patients). The

hazard ratio indicated that the relative risk of developing TD was 0.27 (95% CI, 0.15–0.49) for the rifaximin group, equivalent to approximately one occurrence in four for individuals in the rifaximin group. Secondary end point analyses demonstrated that a significantly smaller percentage of individuals who received rifaximin developed TD (20%) compared with those who received placebo (48%; p < 0.0001; Figure 3). A smaller percentage of individuals who developed TD in the rifaximin group received rescue therapy compared with placebo (14%

vs 32%, Carnitine palmitoyltransferase II respectively; p = 0.003). Additionally, a smaller percentage of individuals who received rifaximin developed TD associated with diarrheagenic E coli (ETEC or EAEC) compared with placebo (9% vs 18%, respectively), although the difference was not significant (p = 0.098). TD was not associated with invasive bacterial pathogens (Campylobacter, Shigella, or Salmonella) in any individual. The percentage of individuals who developed TD associated with unidentified pathogens was significantly lower in the rifaximin versus placebo group (11% vs 30%, respectively; p = 0.01). A greater percentage of individuals who received rifaximin completed the 14-day treatment period without developing TD (76%) versus those who received placebo (51%; p = 0.0004). The percentage of patients who experienced mild diarrhea but did not develop TD was similar between rifaximin and placebo groups (29% rifaximin vs 21% placebo). During the 7-day post-treatment period, the percentage of participants who developed TD was similar for rifaximin (16%) versus placebo (15%).

IRIS events can mimic treatment relapse (see ‘IRIS’). Strong consideration should be given to obtaining a rapid molecular

rifampicin resistance test for all HIV-positive patients with relapse or treatment failure. These are available in TB reference laboratories and advice should be sought from them as soon as the diagnosis is contemplated. Most relapses occur within 6–12 months of completing therapy. In patients with initially drug-susceptible TB, who were treated with rifamycin-containing regimens using DOT, relapse is with susceptible organisms in nearly all cases. In patients who self-administered therapy or received a nonrifamycin regimen, relapse incurs PARP inhibitor a substantial risk of acquired drug resistance. The selection of empirical treatment for BAY 80-6946 cell line patients with relapse should be based on the prior treatment regimen and severity of disease: I. For patients with prior TB caused by drug-susceptible organisms, who received DOT with a rifamycin-based regimen, initiation of the standard four-drug regimen is appropriate until the results of drug susceptibility tests are available. [AII] Treatment

failure is defined as continued or recurrently positive cultures during the course of anti-tuberculosis therapy. After 3 months of multi-drug therapy for pulmonary TB caused by drug-susceptible organisms, up to 98% of patients will have negative cultures and show clinical improvement. All patients with positive cultures after 3 months Glycogen branching enzyme of appropriate treatment must be evaluated carefully to identify the cause of the delayed conversion. Patients whose sputum cultures remain positive after 4 months of treatment should be classified treatment failures. There are many reasons for treatment

failure in patients receiving appropriate regimens. These include: nonadherence; If treatment failure occurs, the case should be referred to a regional centre [1]. M. tuberculosis isolates should be sent to a reference laboratory for drug susceptibility testing to both first- and second-line agents. One of the fundamental principles in managing patients with treatment failure is never to add a single drug to a failing regimen, as this leads to acquired resistance to the new drug. Instead, at least two, and preferably three, new drugs should be added, to which the patient has not been exposed and to which susceptibility is thought likely. Empirical regimens usually include a fluoroquinolone, an injectable agent such as amikacin, and an oral agent such as cycloserine, prothionamide, clarithromycin or PAS. Once drug susceptibility test results are available, the regimen should be adjusted accordingly.

However, the initial rate of killing was lower for P-starved cells than for N-starved cells. The transient resistance of P-starved cells was partially dependent upon the expression of the phosphate (Pho) and Cpx responses. Constitutive 17-AAG ic50 activity of the Cpx and RpoE (σE) envelope stress regulons increased the resistance of P- and N-starved

cells. The level of expression of the RpoE regulon was fourfold higher in P-starved cells than in N-starved cell at the time gentamicin was added. Gentamicin killing of nongrowing cells may thus require ongoing aerobic glucose metabolism and faulty synthesis of structural membrane proteins. However, membrane protein damage induced by gentamicin can be eliminated or repaired by RpoE- and Cpx-dependent mechanisms pre-emptively induced in P-starved cells, which reveals a novel mechanism of resistance to gentamicin that is active in certain circumstances. “
“Microbial sulfidogenesis is the main dissimilatory anaerobic

process in anoxic sediments of extremely haloalkaline soda lakes. In soda lakes with a salinity >2 M of the total Na+ sulfate reduction is depressed, while thiosulfate- and sulfur-dependent sulfidogenesis may still be very active. Anaerobic enrichments at pH 10 and a salinity of 2–4 M total Na+ from sediments of hypersaline soda lakes with thiosulfate and elemental sulfur as electron acceptors and simple nonfermentable Sirolimus manufacturer electron donors resulted in the isolation of two groups of haloalkaliphilic bacteria

capable of dissimilatory sulfidogenesis. Both were closely related to obligately heterotrophic fermentative homoacetogens from soda lakes. The salt-tolerant alkaliphilic thiosulfate-reducing isolates were identified as representatives of Tindallia magadiensis, while the extremely natronophilic obligate sulfur/polysulfide-respiring strains belonged Galactosylceramidase to the genus Natroniella and are proposed here as a novel species Natroniella sulfidigena. Despite the close phylogenetic relation to Natroniella acetigena, it drastically differed from the type strain phenotypically (chemolithoautotrophic and acetate-dependent sulfur respiration, absence of acetate as the final metabolic product). Apparently, in the absence of specialized respiratory sulfidogens, primarily fermentative bacteria that are well adapted to extreme salinity may take over an uncharacteristic ecological function. This finding, once again, exemplifies the importance of isolation and phenotypic investigation of pure cultures. Hypersaline soda lakes represent habitats on Earth maintaining stable highly alkaline pH due to the presence of high concentrations of soluble sodium carbonates. Furthermore, some of the soda lakes are hypersaline, which makes them double extreme (hypersaline and hyperalkaline) habitats. Because of these harsh conditions, only a limited number of prokaryotic groups, known as haloalkaliphiles, are thriving in saturated soda brines.

[16] There is, however, a single publication suggesting that the AIIA losartan may be superior to angiotensin-converting-enzyme inhibitors (ACEIs) in regard to cognitive function[17] and a recent large study of eprosartan demonstrated improved cognition in parallel with decreased blood pressure.[18] It is also worthy of note that in the study of cognition, adherence and Selleckchem MG132 blood pressure by Vinyoles et al.,[3] cited above, lack of cognitive impairment was associated with better

adherence to medication, better blood-pressure control, and use of monotherapy, the most common of which was AIIA (28.6%). We also have data from young, healthy normotensive volunteers showing that a single dose of the AIIA losartan evoked some modest, but statistically significant, improvement in aspects of scopolamine-impaired cognition, notably prospective memory.[19] Prospective memory is that aspect of memory concerning remembering to do something in the future, for example remembering to take a letter for posting

when next going shopping. Prospective memory may be of particular relevance when considering SAHA HDAC ic50 cognitive impairment in the elderly. The aim of this study was to assess the literature concerning the relationship between hypertension, cognitive impairment and the potential benefits of antihypertensive therapy. The ISI Web of Knowledge database was searched using the keywords antihypertensive, hypertension or blood pressure separately combined with cognition, dementia or Alzheimer’s disease. Publications identified were assessed by the author and those relating to animal- or cell-based

studies were excluded, as were editorials, conference abstracts and case reports. Only publications in English or with an English-language abstract were considered further. For the nine searches conducted, the average number of publications Chlormezanone identified for each was 1352, ranging from 185 for ‘antihypertensive’ combined with ‘Alzheimer’s disease’ to 2930 for ‘hypertension’ and ‘dementia’. The earliest identified reference was from 1952.[20] Of the publications identified, 9.9% had been published in 2009, indicating the acceleration of interest in this topic. Because of the large number of critical reviews published recently, it was decided to focus on English-language publications from 2009 or later; 18 original publications meeting the criteria listed above were identified (see Figure 1). Six systematic literature reviews of the subject were published in 2009. Purnell et al.[21] reviewed papers up until 2007 and concluded that hypertension was not associated with Alzheimer’s disease and McGuiness et al.[22] concluded that antihypertensive therapy late in life had no effect on the incidence of dementia, based on a review of papers up until early 2008. Kennelly et al.

Proteins that respond to the changes in copper availability include the assumed copper acquisition protein MopE, c-type heme proteins (SACCP, cytochrome c553o proteins) and several proteins of unknown function. The most intriguing observation is that multi-heme c-type cytochromes are major constituents of the M. capsulatus Bath surfaceome. This is not commonly observed in bacteria, but is a feature shared with the dissimilatory metal-reducing

bacteria. TGF-beta family Their presence on the M. capsulatus Bath cellular surface may be linked to the cells ability to efficiently adapt to changing growth conditions and environmental challenges. However, their possible role(s) in methane oxidation, nitrogen metabolism, copper acquisition, redox-reactions and/or electron transport remain(s) at present an open question. This review will discuss the possible significance of these findings. Methylococcus capsulatus (Bath) is one of the

most extensively studied methanotrophs. Its genome sequence was published in 2004 as check details the first complete genome sequence from an obligate methane oxidizing bacterium (Ward et al., 2004). One of the interesting findings uncovered by the genome sequencing was the extensive redundancy in several biological pathways, including gene duplications covering methane oxidation, carbon assimilation, amino acid biosynthesis, energy metabolism, transport, regulation and environmental sensing. Nintedanib (BIBF 1120) The high content of duplicated genes, and membrane modifying components, including

sterols, and trans fatty acids are consistent with an organism able to adapt to varying growth conditions (Bird et al., 1971; Jahnke et al., 1992; Loffler et al., 2010). Copper has a unique role in the biology of M. capsulatus Bath and its physiology changes dramatically with the bioavailability of this metal ion (recently reviewed by Semrau et al., 2010). At low copper-to-biomass regimes, methane is oxidized by the cytoplasmatic soluble methane monooxygenase (sMMO). When the growth conditions are changed to high copper-to-biomass ratios, sMMO is no longer produced and the methane oxidation is now mediated by a copper-containing particulate methane monooxygenase (pMMO), a regulation that takes place in the sub-μM range of copper (Stanley et al., 1983; Nielsen et al., 1996, 1997). The expression of pMMO is accompanied with the production of an extensive network of intracytoplasmic membranes where the oxidation of methane occurs (Prior & Dalton, 1985). This copper-dependent change in enzyme system for methane oxidation has been demonstrated for several methanotrophs possessing both MMO enzyme systems and is known as the copper switch (Murrell et al., 2000; Semrau et al., 2010).

) has been poorly studied,[1-5] even though these populations are implicitly at high risk of skin cancer. Pleasure craft captains in the tropics are numerous (160,000 per year CHIR-99021 mouse in Martinique, French West Indies). To prepare a prevention campaign

for this population, current sun-protection behaviors of professional skippers sailing in Martinique and the behavior of their passengers should be explored. From September 2010 to January 2011, 53 consecutive professional pleasure craft skippers in Martinique were interviewed with an anonymous, self-administered, print questionnaire, while in the waiting room of the Maritime Affairs Outpatient-Consultation Health Service, where they are convoked annually for a systematic physical examination. The questionnaire, comprising 32 items, collected the sociodemographic and skin characteristics (phototype in four of the six groups of Fitzpatrick classification, dermatological history). Estimation of their sun-protection knowledge was summarized by regrouping the responses pertaining to the following two questions: “In your opinion, what is the recommended frequency of sunscreen application? Every hour, Every 2 hours, Every 4 hours, Every 8 hours” and “Sunscreen protects against the sun better than clothes. What is your opinion? Yes, No, I don’t know.” Knowledge was considered good,

when both GW-572016 cell line questions were answered correctly (“every 2 hours” and “no,”

respectively); intermediate, this website for one correct response; and poor, for no correct answers. Behavior was assessed by estimations of photoprotection and sunburns; simple sunburn was defined as erythema and severe sunburn as “blisters” or the need for analgesics or medical care. The number of sunburns over the last 6 months and on the last sailing day, coupled with the duration of exposure to sun with appropriate photoprotection (sunscreen or clothing) were compiled. Passengers’ sun-protection behavior observed by the skippers was limited to the existence of sunburns, simple or severe, and the sun-protection methods, if any, used, adapted or not adapted, to their exposure. Fifty-two skippers (45 men and 7 women; mean age: 41 years) completed the questionnaire (1 refused). The majority had been boat captains for >10 years. More than half (56%) of them had never undergone medical screening for skin cancer or nevus monitoring; only one had experienced a previous skin cancer. Skin types were distributed as follows: 10% I and II, 46% III, 31% IV, and 13% V and VI. Among them, 38 and 54% had good or intermediate sun-protection knowledge. Reported sun-protection behavior showed that 75% had had a simple sunburn over the last 6 months and 6% severe sunburn; sunscreen use is detailed in Table 1.