Bacterial RNA extraction and RT-PCR Extraction check details of total RNA was done as described previously with slight modification [33]. Briefly, bacteria were harvested, washed, resuspended with buffer containing lysozyme and mutanolysin, and incubated to weaken cell walls. Bacterial pellets were collected and resuspended. Extraction of RNA was done by mixing with hot phenol followed by vortex and centrifugation. The upper aqueous phase was collected and precipitated. RNA was treated with DNase and re-extracted again. 1 μg extracted RNA was reverse-transcribed to cDNA in total 20 μl reactive solution by

Improm II RT kit (Promega). The expression of sfb, prtF1, oppA, speB, scl1, and scl2 was assessed by PCR with primers sfb-1 (CCTCTAGCGGGTGAGTCT), sfb-2 (AATGGAACACTGAATTCGGACGGG), prtF1-1 (TTTTCAGGAAATATGGTTGAGACA),

prtF1-2 (TCGCCGTTTCACTGAAACCACTCA), oppA-1 (TGGTATACGGCTGATGGTGA), oppA-2 (GCTTTCTTACCGGCATCTTG), speB-1 (TGATGGCTGATGTTGGTATTTC), speB-2 (ATTCTTTGTCAATTTGTGCTTCC), scl1-6 (ATGTTGACATCAAAGCAC), scl1-4 (CCTTTTTCACCCTTTTCGCC), scl2-1 (TGCTGACCTTTGGAGGTGC), and scl2-2 (CGCCTGTTGCTGGCAATTGTC). Genomic DNA was used as a positive control to confirm the size of PCR product, and the extracted RNA was used as a negative control to exclude the possibility of DNA contamination. Adhesion assay Human epidermoid carcinoma epithelial cells (HEp-2; ATCC CCL-23) and C2C12 mouse myoblasts (ATCC CRL-1772) were cultured in DMEM supplemented with 10% FCS. HUVECs R406 manufacturer were cultured on 0.04% gelatin-coated (Sigma) plates in M199 supplemented with 2 mM L-glutamine (Invitrogen), 10% FBS, and 25% EGM. Adhesion of FITC-conjugated bacteria to cells was measured using a previously described method with slight modifications [34, 35]. Bacteria were suspended in cell culture medium to a density of 4 × 108 cells/ml. FITC-conjugated bacterial suspension was added to the confluence cells at a M.O.I. of 100 and incubated for 2 hrs at 37°C. The fluorescence of each well was measured by a CytoFluor II flourescence

reader (Millipore) with excitation and detection wavelength of Cyclooxygenase (COX) 485 nm and 530 nm, respectively. Compared to the results from the conventional plating experiment, the FITC conjugation did not affect the adherence of bacteria. Blocking assay For the proteolytic treatment of bacteria, the bacterial suspension (108 CFU/ml) was incubated with proteinase K (10 μg/ml) for 1 h at 37°C. The suspension was washed and re-suspended in 1 ml of PBS for the subsequent FITC-conjugation and adhesion assay. In the antibody blocking assay, FITC-conjugated bacteria was incubated with selleck chemical anti-Scl1 antibody (10 μg/ml) for 30 min at room temperature. In the recombinant protein blocking assay, HEp-2 cells were pre-incubated with recombinant Scl1 protein (10 μg/ml), and subsequently incubated with FITC-conjugated bacteria for the adhesion assay.